Reference health
A Genome-Wide, Mapped Algal Mutant Library Enables High-Throughput Genetic Studies in a Photosynthetic Eukaryote
77/77 checkable references clean · checked 2026-08-29
Every reference with a DOI in the deposited reference list resolved to a known work in Crossref or DataCite at the dated check, and none carried a retraction, withdrawal, or removal notice.
64 without a DOI — not checked. A reference deposited without a DOI is never matched by title or guessed at; it stays outside the checked set, and this line discloses that.
The 77 checked references that resolve
resolves10.1093/jxb/ert237
A mutation in the FZL gene of Arabidopsis causing alteration in chloroplast morphology results in a lesion mimic phenotype
resolves10.1074/jbc.m610249200
Loss of Phylloquinone in Chlamydomonas Affects Plastoquinone Pool Size and Photosystem II Synthesis
resolves10.1046/j.1365-313x.2003.01952.x
The universally conserved HCF101 protein is involved in assembly of [4Fe‐4S]‐cluster‐containing complexes in <i>Arabidopsis thaliana</i> chloroplasts
resolves10.1016/S0092-8674(04)00450-7
Comparative Genomics Identifies a Flagellar and Basal Body Proteome that Includes the BBS5 Human Disease Gene
resolves10.1105/tpc.112.105106
A Galactoglycerolipid Lipase Is Required for Triacylglycerol Accumulation and Survival Following Nitrogen Deprivation in <i>Chlamydomonas reinhardtii</i>
resolves10.1105/tpc.15.00465
An Indexed, Mapped Mutant Library Enables Reverse Genetics Studies of Biological Processes in <i>Chlamydomonas reinhardtii</i>
resolves10.1093/mp/sss012
Carbonylation and Loss-of-Function Analyses of SBPase Reveal Its Metabolic Interface Role in Oxidative Stress, Carbon Assimilation, and Multiple Aspects of Growth and Development in Arabidopsis
resolves10.1073/pnas.1522866113
A repeat protein links Rubisco to form the eukaryotic carbon-concentrating organelle
resolves10.1111/tpj.12385
<scp>ABC</scp>1<scp>K</scp>1/<scp>PGR</scp>6 kinase: a regulatory link between photosynthetic activity and chloroplast metabolism
resolves10.1016/j.jbiotec.2015.05.009
Isolation of Chlamydomonas reinhardtii mutants with altered mitochondrial respiration by chlorophyll fluorescence measurement
resolves10.1126/science.1143609
The
<i>Chlamydomonas</i>
Genome Reveals the Evolution of Key Animal and Plant Functions
resolves10.1186/1746-4811-8-21
A new method to identify flanking sequence tags in chlamydomonas using 3’-RACE
resolves10.1104/pp.110.165159
Changes in Transcript Abundance in
<i>Chlamydomonas reinhardtii</i>
following Nitrogen Deprivation Predict Diversion of Metabolism
resolves10.1016/j.sbi.2016.08.005
Unveiling the functional diversity of the alpha/beta hydrolase superfamily in the plant kingdom
resolves10.1038/ng.1106
Mutations in axonemal dynein assembly factor DNAAF3 cause primary ciliary dyskinesia
resolves10.1105/tpc.106.049270
The Balance between Protein Synthesis and Degradation in Chloroplasts Determines Leaf Variegation in<i>Arabidopsis yellow variegated</i>Mutants
resolves10.1128/ec.00203-09
RNA Interference Silencing of a Major Lipid Droplet Protein Affects Lipid Droplet Size in
<i>Chlamydomonas reinhardtii</i>
resolves10.1104/pp.17.00349
A Plant Cryptochrome Controls Key Features of the
<i>Chlamydomonas</i>
Circadian Clock and Its Life Cycle
resolves10.1083/jcb.151.3.709
<i>Chlamydomonas IFT</i>
88 and Its Mouse Homologue, Polycystic Kidney Disease Gene
<i>Tg</i>
737, Are Required for Assembly of Cilia and Flagella
resolves10.1105/tpc.105.037689
LOW PSII ACCUMULATION1 Is Involved in Efficient Assembly of Photosystem II in
<i>Arabidopsis thaliana</i>
resolves10.1093/emboj/18.22.6481
A factor related to pseudouridine synthases is required for chloroplast group II intron trans‐splicing in Chlamydomonas reinhardtii
resolves10.1016/j.cell.2016.05.003
A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria
resolves10.1038/nature19358
A blue-light photoreceptor mediates the feedback regulation of photosynthesis
resolves10.1038/nprot.2007.427
Genome-wide analysis of barcoded Saccharomyces cerevisiae gene-deletion mutants in pooled cultures
resolves10.1186/s13007-017-0170-x
A robust protocol for efficient generation, and genomic characterization of insertional mutants of Chlamydomonas reinhardtii
resolves10.1104/pp.110.157875
Identification and Regulation of Plasma Membrane Sulfate Transporters in Chlamydomonas
resolves10.1371/journal.pbio.1000288
Role of Plastid Protein Phosphatase TAP38 in LHCII Dephosphorylation and Thylakoid Electron Flow
resolves10.1111/nph.2016.209.issue-1
resolves10.1016/s0960-9822(01)00122-1
An autosomal recessive polycystic kidney disease gene homolog is involved in intraflagellar transport in C. elegans ciliated sensory neurons
resolves10.1128/ec.4.2.242-252.2005
Annotation of Genes Involved in Glycerolipid Biosynthesis in
<i>Chlamydomonas reinhardtii</i>
: Discovery of the Betaine Lipid Synthase BTA1
<sub>Cr</sub>
resolves10.1093/emboj/20.7.1765
Identification of an RNA–protein complex involved in chloroplast group II intron trans‐splicing in Chlamydomonas reinhardtii
resolves10.1038/182098a0
Pigments and Photosynthesis in a Carotenoid-Deficient Mutant Of chlamydomonas
resolves10.1105/tpc.112.095703
Identification of a Photosystem II Phosphatase Involved in Light Acclimation in
<i>Arabidopsis</i>
resolves10.1105/tpc.106.042895
The Nuclear-Encoded Factor HCF173 Is Involved in the Initiation of Translation of the <i>psbA</i> mRNA in <i>Arabidopsis thaliana</i>
resolves10.1073/pnas.0913810107
The PPH1 phosphatase is specifically involved in LHCII dephosphorylation and state transitions in Arabidopsis
resolves10.1038/srep27810
CRISPR/Cas9-induced knockout and knock-in mutations in Chlamydomonas reinhardtii
resolves10.2478/s11756-008-0146-4
Is it possible to improve homologous recombination in Chlamydomonas reinhardtii?
resolves10.1104/pp.106.078147
The Evolutionarily Conserved Tetratrico Peptide Repeat Protein Pale Yellow Green7 Is Required for Photosystem I Accumulation in Arabidopsis and Copurifies with the Complex
resolves10.1093/pcp/pcv012
AtCCR4a and AtCCR4b are Involved in Determining the Poly(A) Length of Granule-bound starch synthase 1 Transcript and Modulating Sucrose and Starch Metabolism in Arabidopsis thaliana
resolves10.1093/genetics/135.2.375
Cloning of flagellar genes in Chlamydomonas reinhardtii by DNA insertional mutagenesis.
resolves10.1093/molbev/mss178
PredAlgo: A New Subcellular Localization Prediction Tool Dedicated to Green Algae
resolves10.1007/s00294-011-0339-1
The chloroplast proteome: a survey from the Chlamydomonas reinhardtii perspective with a focus on distinctive features
resolves10.1093/oxfordjournals.jbchem.a022576
Cloning of Phosphatase I Gene from a Psychrophile, Shewanella sp., and Some Properties of the Recombinant Enzyme
resolves10.2210/pdb1v73/pdb
Crystal Structure of Cold-Active Protein-Tyrosine Phosphatase of a Psychrophile Shewanella SP.
resolves10.1104/pp.111.182493
Two Ancient Bacterial-like PPP Family Phosphatases from Arabidopsis Are Highly Conserved Plant Proteins That Possess Unique Properties
resolves10.1016/j.mib.2011.10.005
Evolution of sex and mating loci: An expanded view from Volvocine algae
resolves10.1074/jbc.m505729200
STN8 Protein Kinase in Arabidopsis thaliana Is Specific in Phosphorylation of Photosystem II Core Proteins
resolves10.1105/tpc.114.126607
Repair of Site-Specific DNA Double-Strand Breaks in Barley Occurs via Diverse Pathways Primarily Involving the Sister Chromatid
resolves10.1074/mcp.m114.038281
The Global Phosphoproteome of Chlamydomonas reinhardtii Reveals Complex Organellar Phosphorylation in the Flagella and Thylakoid Membrane
resolves10.1073/pnas.1606519113
Chloroplast-mediated regulation of CO
<sub>2</sub>
-concentrating mechanism by Ca
<sup>2+</sup>
-binding protein CAS in the green alga
<i>Chlamydomonas reinhardtii</i>
resolves10.1016/j.bbabio.2009.07.009
Redox and ATP control of photosynthetic cyclic electron flow in Chlamydomonas reinhardtii (I) aerobic conditions
resolves10.1111/j.2517-6161.1995.tb02031.x
Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing
resolves10.1078/14344610260450136
An Engineered Streptomyces hygroscopicus aph 7″ Gene Mediates Dominant Resistance against Hygromycin B in Chlamydomonas reinhardtii
resolves10.1111/j.1365-313x.2011.04537.x
A revised mineral nutrient supplement increases biomass and growth rate in <i>Chlamydomonas reinhardtii</i>
resolves10.14806/ej.17.1.200
Cutadapt removes adapter sequences from high-throughput sequencing reads
resolves10.1016/s0005-2728(89)80347-0
Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy
resolves10.1105/tpc.114.124099
High-Throughput Genotyping of Green Algal Mutants Reveals Random Distribution of Mutagenic Insertion Sites and Endonucleolytic Cleavage of Transforming DNA
The 64 references without a DOI — listed, not checked
no DOI — not checkedref1
no DOI — not checkedref8
no DOI — not checkedref10
no DOI — not checkedref14
no DOI — not checkedref18
no DOI — not checkedref22
no DOI — not checkedref23
no DOI — not checkedref27
no DOI — not checkedref30
no DOI — not checkedArabidopsis thaliana and their characterisation by spectroscopy, immunoblotting and northern 1044 hybridisation
no DOI — not checkedref35
no DOI — not checkedref46
no DOI — not checkedref50
no DOI — not checkedA robust protocol for efficient generation, and genomic characterization of 1085 insertional mutants of Chlamydomonas reinhardtii
no DOI — not checkedref57
no DOI — not checkedref63
no DOI — not checkedref66
no DOI — not checkedCRISPR/Cas9-induced knockout and knock-in mutations in Chlamydomonas 1120 reinhardtii
no DOI — not checkedref73
no DOI — not checkedFast, scalable generation of high-quality protein multiple sequence 1123 alignments using Clustal Omega
no DOI — not checkedModulating Sucrose and Starch Metabolism in Arabidopsis thaliana
no DOI — not checkedref82
no DOI — not checkedref84
no DOI — not checkedref89
no DOI — not checkedref97
no DOI — not checkedAn additional complication of 1807 the new corrected insertion positions was presented by the fact that the position of the nearest 1808 distal LEAP-Seq read is always at some distance from the true insertion position, depending on 1809 the length of the LEAP-Seq read. We attempted to correct for this by using confidence 1 1810 insertions to determine the average distance between the proximal read (reflecting the true 1811 insertion position) and the nearest distal read, separately for 5' and 3' datasets, depending on 1812 the total number of LEAP-Seq reads for the insertion (binned into ranges: 1, 2, 3, 4-5, 6-10, 11-1813 20, 21+ total reads). For each confidence 4 insertion with a corrected position, the position was 1814 further adjusted by the average distance for the correct side and number of reads as calculated 1815 above
no DOI — not checkedref99
no DOI — not checkedbut using 30 bp 1821 flanking sequence lengths instead of a mix of 20 bp and 21 bp (since we now use 30 bp flanking 1822 sequence data derived from LEAP-Seq, rather than 20/2 1bp ChlaMmeSeq sequences), and 1823 using the v5.5 Chlamydomonas genome. This analysis was done on the original full set of 1824 mapped insertions, to avoid introducing bias from the choice of mutants into the consolidated 1825 set. The hot/cold spot analysis was performed on confidence 1 insertions only, to avoid 1826 introducing bias caused by junk fragments and their imperfect correction
no DOI — not checkedref101
no DOI — not checked1856 with minor modifications. 72 mutants were chosen randomly from the library (24 insertions each 1857 for confidence levels 1&2, confidence level 3 and confidence level 4), streaked to single 1858 colonies and grown on solid TAP agar plates with paromomycin under low light (< 5 ?mol 1859 photons m -2 s -1 ). A single colony of each mutant was picked and inoculated into 30 mL TAP 1860 liquid medium and grown up on a shaker at 150 rpm under low light. Cells were harvested by 1861 centrifugation at 1000 x g for 4min at 4�C. Most of the supernatant was removed and cell pellets 1862 were resuspended in the remaining supernatant, transferred to a 1.5 mL tube, then pelleted at 1863 10,000 x g for 1 min to completely remove supernatant, and finally stored at -80�C. The frozen 1864 cell pellets were
no DOI — not checkedref103
no DOI — not checked15 �L H 2 O, 0.1 �L Taq DNA Polymerase, 1.25 �L of 1870 each primer at 10 �M, and 1 �L of 10 ng/�L Chlamydomonas genomic DNA. PCR cycling 1871 parameters were: 5 min at 95�C, 40 cycles of 30 s at 95�C, 45 s at 58�C, 2 min at 72�C, 1872 followed by a final extension of 10 min at 72�C. Primers were designed to anneal 1-1.5 kb away 1873 on each side of the insertion site indicated by alignment of the flanking sequence to the genome 1874 (Dataset S5). PCR products of the expected size were gel extracted and submitted for Sanger 1875 sequencing by
no DOI — not checkedGenomic 1877 locus amplification: genomic primers that are ~1 kb away from the flanking genomic sequence 1878 reported by LEAP-Seq were used to amplify the genomic locus around the flanking sequence. If 1879 CC-4533 (wild-type) produced the expected PCR band but the mutant did not produce it or 1880 produced a much larger product, this indicated that the genomic locus reported by LEAP-Seq 1881 93 may be disrupted by the insertional cassette and we proceeded to the second step
no DOI — not checkedside and omj944 for the 3' side) and the other primer binding to flanking Chlamydomonas 1884 genomic DNA (one of the genomic primers from the 1 st step) were used to amplify genomic-1885 cassette junction. If the mutant produced a PCR band with expected size that was confirmed by 1886 sequencing but CC-4533 (wild-type) did not produced the expected PCR band, we categorized 1887 this insertion as "confirmed
no DOI — not checked2014) was 1894 digested with 10X StuI enzyme (R0187L, New England Biolabs) overnight at 37�C. The 1895 digestion reaction contained 10 �L 10x NEB buffer 4, 5 uL Stul at 10 units/uL
no DOI — not checkedThe overnight digestion was continued the next 1897 day for another 4-5 hours after adding 2�L fresh Stul at 10 units/�L to ensure complete 1898 digestion. The digested fragments were separated on a 0.7% Tris-borate-EDTA (TBE) agarose 1899 gel (w/v) at 30 V at 4�C overnight for 17 h and then for 5 additional h at 70 V. The gel was first 1900 depurinated in 0.25 M HCl for 15 min at room temperature
no DOI — not checked1M NaCl on a shaker for 30 minutes
no DOI — not checkedBio-Rad) overnight using the alkaline transfer protocol given in the manual 1904 accompanying the membrane. The next day, the membrane was gently washed on a shaker 1905 with 2X saline-sodium citrate
no DOI — not checked25 �L Phusion HSII Polymerase, 1.25 1909 �L of each primer at 10 �M (oMJ588, GACGACGCCCTGAGAGCCCT; oMJ589, 1910 TTAAAAAAATTCGTCCAGCAGGCG), and 1 �L CIB1 cassette DNA at 7.5 ng/�L. PCR cycling 1911 parameters were: 90 s at 98�C, 40 cycles of 15 s at 98�C, 30 s at 70�C, 60 s at 72�C, followed 1912 by a final extension of 10 min at 72�C. The PCR band at 800 bp was gel extracted using Qiagen 1913 gel extraction MinElute kit (28006, Qiagen)
no DOI — not checkedref112
no DOI — not checkedref113
no DOI — not checkedref114
no DOI — not checkedref115
no DOI — not checkedAliquots of 2x10 8 cells were 1930 pelleted (1000 X g, 5 min, room temperature) by centrifugation and frozen as initial pool 1931 samples. For pooled growth, 20-L cultures were inoculated with 2x10 4 cells
no DOI — not checkedCultures were mixed using a conventional magnetic stir 1933
no DOI — not checkedref118
no DOI — not checkedref119
no DOI — not checkedThe barcode read counts for each dataset were 1945 normalized to a total of 100 million. Each barcode with at least 50 normalized reads in the TAP-1946 dark dataset was classified as a hit if its ratio of normalized TP-light:TAP-dark read counts was 1947 0.1 or lower, or a non-hit otherwise. The fraction of hit barcodes was 3
no DOI — not checkedref121
no DOI — not checkedThe final list of tier I genes was 1961 generated by taking genes with an FDR-corrected p-value of 0.3 or less in either replicate -this 1962 value was chosen in order to include all genes with 2 hit alleles and 0 non-hit alleles. The 1963 resulting list of hits included 37 genes in replicate 1, 34 in replicate 2, 44 total. The FDR-1964 corrected p-values for the hits in both replicates are shown in Table 1 and Table 2. Additionally, 1965 the list of tier II genes was generated by taking genes with a p-value of 0.058 or less -this value 1966 was chosen to include genes with only one allele with a phenotype and no alleles without a 1967 phenotype, but to exclude genes with one allele with and one without a phenotype. The 1968 resulting list included 264 genes total
no DOI — not checkedref124
no DOI — not checkedref125
no DOI — not checkedref126
no DOI — not checkedFor genotyping of cpl3 and CC-4533, PCR reactions were performed as previously 1977 described
no DOI — not checked1982 which confers resistance to hygromycin B. In this construct, the expression of CPL3 is under the 1983 control of the PSAD promoter. The construct was linearized before being transformed into the 1984 cpl3 mutant. Transformants were robotically arrayed and assayed in colony sizes in the 1985 presence and absence of acetate respectively
no DOI — not checkedref129
no DOI — not checkedref130
no DOI — not checkedref131
no DOI — not checkedPrior to 1996 measurements, cells were incubated in the dark, with vigorous shaking, for 15-20 min. Light 1997 response curves were generated by exposing cells to increasing light intensities, with the time at 1998 each intensity step lasting 1 min. The maximal quantum efficiency of PSII was calculated as 1999 (Fm'-F0)/Fm'. The quantum efficiency of PSII during exposure to each light intensity was
no DOI — not checkedref133
no DOI — not checked23�C) and re-suspended to a 2004 concentration of 30 �g mL -1 Chl in fresh media supplemented with 10% Ficoll PM400. Dark-2005 adapted cells were exposed to 156 �mol photons m -2 s -1 during PSI oxidation followed by a 2006 saturating pulse, and re-reduction period in the dark. Redox changes at P 700 were monitored at 2007 705 nm. The absorption changes measured at 740 nm were subtracted to correct for unspecific
no DOI — not checkedref135
no DOI — not checkedref147
no DOI — not checkedref154
What this badge says. CiteStamped means the CHECKABLE references of this
work were clean at the dated check: each resolved to a known work in a public registry, and none
carried a retraction notice at that time. It says nothing about the quality, findings,
or importance of the work itself, and nothing about references deposited without a DOI.
checked 2026-08-29 — re-checked daily as this page is visited; titles and statuses come from Crossref and DataCite and are not part of the signed record
Embed this badge
Both snippets point at the live badge image and link back to this page. The badge re-renders from the daily check, so an embed never goes stale by more than a day of visits.
<a href="https://citestamp.com/citestamped/10.2139/ssrn.3155767"><img src="https://citestamp.com/citestamped/10.2139/ssrn.3155767/badge.svg" alt="CiteStamped reference-health badge" width="460" height="64"></a>
[](https://citestamp.com/citestamped/10.2139/ssrn.3155767)